Concept icon
Concept

RT-PCR test for SARS-CoV-2 virus RNA

Clinical specimens collection and RT-PCR test for SARS-CoV-2 were previously described18. Clinical specimens in COVID-19 patients included nasal swabs, throat swabs, sputum, anal swabs, and bronchoalveolar lavage (BAL), and clinical specimens in healthcare providers without confirmed COVID-19 diagnosis were only throat swabs. In brief, clinical specimens were collected from these people by trained nurses or physicians wearing proper personal protection equipment. RT-PCR tests for SARS-CoV-2 were performed using a nucleic acid detection kit following the manufacturer’s protocol. The test simultaneously amplifies and detects two target genes, including open reading frame 1ab (ORF1ab) and nucleocapsid protein (N). Primers used for those two target genes are as follows: ORF1ab: forward primer CCCTGTGGGTTTTACACTTAA, reverse primer ACGATTGTGCATCAGCTGA; and the probe 5 -VIC-′CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3; N: forward primer ′GGGGAACTTCTCCTGCTAGAAT, reverse primer CAGACATTTTGCTCTCAAGCTG, and the probe 5'-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3'. Conditions for the amplifications were incubation at 50 °C for 15 minutes and 95 °C for 5 minutes, followed by 40 cycles of denaturation at 94 °C for 15 seconds and extension at 55 °C for 45 seconds. The diagnostic criteria for positive and negative RT-PCR results were based on the recommendation by the National Institute for Viral Disease Control and Prevention (China): positive result <37 cycle threshold value (Ct-value) and negative result ≥ 40. A Ct-value of 37-39 required retesting.

0

1

Concept icon
Updated 2020-07-24

Tags

SARS-CoV-2 (COVID-19)

Biomedical Sciences