Serum samples from these people were collected. Methods for testing serum IgM and IgG antibodies to SARS-CoV-2 were previously described.50 COVID-19 IgM/IgG test kits contained recombinant SARS-CoV-2 antigens (spike protein and nucleocapsid protein) labelled with magnetic beads (tested on a fully automated chemiluminescence immunoassay analyzer) or colloidal gold (test card), anti-human IgM monoclonal antibody, and anti-human IgG monoclonal antibody. These test kits were reported to have high sensitivity and specificity27,50. According to the manufacturers, the sensitivity and specificity are ~90% and >99% for IgM, and ~98% and ~98% for IgG, respectively. Two physicians extracted the following data using data collection form from electronic medical records: demographic information such as age and sex, RT-PCR test date and results, COVID-19 IgM/IgG test date and results, date of symptom onset for COVID-19 patients, treatments received, and clinical outcomes. Another physician in the research team reviewed the collected data.


COVID-19 IgM/IgG test for antibodies against SARS-CoV-2

Clinical specimens collection and RT-PCR test for SARS-CoV-2 were previously described18. Clinical specimens in COVID-19 patients included nasal swabs, throat
swabs, sputum, anal swabs, and bronchoalveolar lavage (BAL), and clinical specimens in healthcare providers without confirmed COVID-19 diagnosis were only throat swabs. In brief, clinical specimens were collected from these people by trained nurses or physicians wearing proper personal protection equipment. RT-PCR tests for SARS-CoV-2 were performed using a nucleic acid detection kit following the manufacturer’s protocol. The test simultaneously amplifies and detects two target genes, including open reading frame 1ab (ORF1ab) and nucleocapsid protein (N). Primers used for those two target genes are as follows: ORF1ab: forward primer CCCTGTGGGTTTTACACTTAA,
reverse primer ACGATTGTGCATCAGCTGA; and the probe 5
-VIC-′CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3; N: forward primer
′GGGGAACTTCTCCTGCTAGAAT, reverse primer CAGACATTTTGCTCTCAAGCTG,
and the probe 5'-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3'. Conditions for the
amplifications were incubation at 50 °C for 15 minutes and 95 °C for 5 minutes, followed by 40 cycles of denaturation at 94 °C for 15 seconds and extension at 55 °C for 45 seconds. The diagnostic criteria for positive and negative RT-PCR results were based on the recommendation by the National Institute for Viral Disease Control and Prevention (China): positive result <37 cycle threshold value (Ct-value) and negative result ≥ 40. A Ct-value of 37-39 required retesting.



RT-PCR test for SARS-CoV-2 virus RNA

The methodology for investigating the prevalence of IgG antibodies to SARS-CoV-2 in Wuhan involved two primary testing procedures. First, an RT-PCR test was used to detect the presence of SARS-CoV-2 virus RNA. Second, a COVID-19 IgM/IgG test was utilized to identify antibodies against the SARS-CoV-2 virus.

Northwestern University

Google

This MedRxiv Paper fully titled "Prevalence of IgG antibodies to SARS-CoV-2 in Wuhan–implications for the ability to produce long-lasting protective antibodies against SARS-CoV-2" investigates how long antibodies against SARS-CoV-2 last in the body.

-  Found that IgG prevalence increased significantly by age among healthcare workers and general workers, but that otherwise rates were low. Very few healthcare providers had IgG antibodies to SARS-CoV-2, though a significant proportion of them had been infected with the virus. After SARS-CoV-2 infection, people are unlikely to produce long-lasting protective antibodies against this virus.
-  Has significant implications for herd immunity, antibody-based therapeutics,
public health strategies, and vaccine development.
-  Also has findings that refute the possibility of using SARS-CoV anitbody therapies for SARS-CoV-2

https://www.medrxiv.org/content/10.1101/2020.06.13.20130252v1.full.pdf

Prevalence of IgG antibodies to SARS-CoV-2 in Wuhan–implications for the ability to produce long-lasting protective antibodies against SARS-CoV-2

Study includes the following four groups of individuals who received both COVID-19 IgM/IgG tests and RT-PCR tests for SARS-CoV-2 from February 29, 2020 to April 29, 2020: 
-  1470 hospitalized patients with COVID-19 from Leishenshan Hospital, Zhongnan Hospital of Wuhan University, and Wuhan No. 7 Hospital 
-  3832 healthcare providers without COVID-19 diagnosis
-  19555 general workers
--1616 other patients to be admitted to the hospital 
(N=26473)

Mean age was 58.7 years in 1470 COVID-19 patients, 37.1 years in 3832 healthcare providers, 41.6 years in 19555 general workers and 53.3 years in other patients (Table 1). Hospitalized COVID-19 patients were composed of more older people, while healthcare providers and general workers were mostly young adults. Among COVID-19 patients, median time from symptom onset to IgM/IgG test was 41 days (interquartile range 33-50 days). The last RT-PCR tests for SARS-CoV-2 were positive in only eight COVID-19 patients and none of three patients was tested negative for IgG antibodies to SARS-CoV-2.


Characteristics of Participants

We analyzed prevalence of IgG antibodies to SARS-CoV-2 in hospitalized COVID-19 patients, healthcare providers without a confirmed COVID-19 diagnosis, general workers, and other patients to be admitted to hospital. The most intriguing finding of this study is that only 4% of healthcare providers without confirmed COVID-19 diagnosis had IgG antibodies to SARS-CoV-2 in their blood.

Zhongnan Hospital of Wuhan University, 2.88% (118/4099) healthcare
workers were diagnosed with COVID-19 before March 16, 2020. With a moderate estimation, the true infection rate would be ten times that had been confirmed, i.e., >25% of those healthcare providers without diagnosed COVID-19 had been infected. However, only 4% of those infected healthcare workers without confirmed COVID-19 still had IgG antibodies to SARS-CoV-2. They just got infected with SARS-CoV-2 and cleared the virus by their own immune systems. No long-lasting protective antibodies against SARS-CoV-2 were produced in these healthcare providers. Our observed high prevalence of IgG antibodies to SARS-CoV-2 in older groups (60-69 years old and ≥70 years old) among health care workers and general worker in Wuhan also raised the concern that IgG antibodies to SARS-CoV-2 would be lost some time after the infection was cleared

We also found that >10% of confirmed COVID-19 cases had no detectable serum levels of IgG antibodies to SARS-CoV-2 after 21 days post symptom onset. They were unlikely to not produce IgG antibodies to SARS-CoV-2 after being infected with the virus. Long et al reported that after 17-19 days post symptom onset, IgG was positive in all patients with COVID-19.  Therefore, >10% patients in our study who had no IgG antibodies after 21 days post symptom onset most likely lost those IgG antibodies after the infection was resolved.

We found mortality risks were similar between hospitalized COVID-
19 patients with IgG antibodies to SARS-CoV-2 and those without, which indicates that absence of IgG antibodies may not affect clinical end outcome and IgG antibodies may even not be part of short-term protective immune response against SARS-CoV-2.

In conclusion, very few healthcare providers without confirmed COVID-19 diagnosis in Wuhan have IgG antibodies to SARS-CoV-2, though a substantial portion of them had been infected with the virus. More than 10% of COVID-19 patients did not have those antibodies after 21 days post symptom onset.  After SARS-CoV-2 infection, people are unlikely to produce long-lasting protective antibodies against this virus.


Discussion and Conclusion for Antibody Longevity

Prevalence of IgG antibodies to SARS-CoV-2 was 89.8% (95% CI 88.2-91.3%) in
COVID-19 patients (Table 2) compared to 4.0% (95% CI 3.4-4.7%) in healthcare
providers, 4.6% (95% CI 4.3-4.9%) in general workers, and 1.0% in other patients (p all <0.001 for comparing to COVID-19 patients). Only the comparison of IgG prevalence between healthcare workers and general workers was not significant (p=0.39). IgG prevalence increased significantly by age among healthcare providers, and was 2.8% in those <30 years old, 9.6% in those 60-69 years old and 10.0% in those ≥ 70 years old (p<0.001 for trend). IgG prevalence also increased significantly by age among general workers. Prevalence of IgM antibodies to SARS-CoV-2 was 31.4% (95% CI 29.0-33.7%) in COVID-19 patients, 1.5% (95% CI 1.1-1.8%) in healthcare providers, 1.3 (95% CI 1.1-1.5%) in general workers, and 0.2% (95% CI 0-0.4%) in other patients (Table 3).

Among COVID-19 patients, mean age was similar between those with IgG antibodies to SARS-CoV-2 and those without (Table 4). Presence of IgG antibodies to SARS-CoV-2 was not associated with most demographic characteristics, disease severity, presence of comorbidities, treatment received, and clinical characteristics, except for antibiotics treatment, chloroquine/hydroxychloroquine treatment, and needing intubation. IgG prevalence and IgM prevalence among hospitalized patients with COVID-19 by demographic and clinical characteristics are presented in Table 5. Mortality rate was 1.3% (95% CI 0.7-1.9%) in those with IgG antibodies to SARS-CoV-2 and was 3.3% (95% CI 0.4-6.2%) in those without (Figure 1). Mortality risk was similar between those with IgG antibodies to SARS-CoV-2 and those without (adjusted hazard ratio 0.45 95% CI 0.16-1.24, P=0.12).


Prevalence and Mortality regarding IgG Antibody presence in SARS-CoV-2 patients

-  First, as infected people do not develop long-lasting protecting antibodies against SARS-CoV-2, the idea of immune certificate for recovered COVID-19 patients is invalid. This finding also raises concerns for reinfection, chronic infection, and validity of the herd immunity theory for SARS-CoV- 2. 
-  Second, COVID-19 IgG antibodies as tested by the kits may simply serve as a sign of the infection status and might not be protective neutralizing antibodies. The utilization of convalescent serum from recovered COVID-19 patients in clinical settings48 would be questionable. Clinical trials on the efficacy of convalescent serum from recovered COVID-19 patients in treating COVID-19 cases were conducted in Wuhan. Their results will provide further evidence to help elucidate the role of COVID-19 IgG antibodies. 
-  Third, as serum COVID-19 IgM/IgG level can become undetectable after recovery in patients with SARS-CoV-2 infections, COVID-19 IgM/IgG test will not be a reliable tool for the surveillance of past infections of SARS-CoV-2 in areas where the epidemic is over. 
-  Finally, in our study, most of the healthcare providers without a confirmed COVID- 19 diagnosis have been exposed to the wild-type SARS-CoV-2 virus in a highly contagious environment. However, none of them developed long-lasting protective antibodies against SARS-CoV-2. These findings raise the concern if the inactivated virus, subunit, and recombinant vaccines currently under development will be able to induce effective immune protections against SARS-CoV-2.


Implications for herd immunity, antibody-based therapeutics, public health strategies, and vaccine development.

After infection with SARS-CoV-1, patients start to produce SARS-specific IgG antibody in the second week, which persists for a long time31,32. Even after 210 days after symptom onset, neutralizing viral antibodies (anti-viral IgG) are still detectable in recovered SARS patients33. It is believed that the Spike protein and nucleocapsid protein play a central role in the antibody production31,32,34. Research has focused on developing vaccines and therapeutics targeting the Spike protein35,36 and the nucleocapsid protein37. However, our findings indicate that people are unlikely to develop long-lasting neutralizing antibodies to SARS-CoV-2 after SARS-CoV-2 infection. Cross-reactive antibodies in convalescent SARS patients' sera can neutralize other human betacoronaviruses40, as those viruses share a significant B-cell epitope overlapping the heptad repeat-2 region of the Spike protein. SARS-CoV-2 also belongs to betacoronaviruses. However, no individuals or populations had shown explicit immunity to SARS-CoV-2 and every human being in the world was susceptible to this virus before it first jumped from wild animals to humans. It might be due to the dramatic differences between SARS-CoV-1 and SARS-CoV-2 in the receptor-binding region of Spike protein and the key amino acid residues involved in the interaction with human ACE2

Using SARS-CoV antibodies for SARS-CoV-2

-  Figure 1
-  Table 1
-  Table 2
-  Table 3
-  Table 4
-  Table 5

Learn Before

Related

Learn After